Recursos informáticos para Biólogos.

Microsatellite repeats finder

Sequence:
AACAATGCCATGATGATGATTATTACGACACAACAACACCGCGCTTGACGGCGGCGGATGGATGCCG CGATCAGACGTTCAACGCCCACGTAACGTAACGCAACGTAACCTAACGACACTGTTAACGGTACGAT
Length of repeated sequence: Minimum:23456   Maximum:345678910
Minimum number of repeats: 23456
Minimum length of tanden repeat: 567891011121314151617181920
Allowed percentaje of mismatches: 00.10.20.3

---

Definitions
Microsatellite Repeat:
A variety of simple di- (DINUCLEOTIDE REPEATS), tri- (TRINUCLEOTIDE REPEATS), tetra-, and pentanucleotide tandem repeats (usually less than 100 bases long).

Tandem repeats:
Copies of DNA sequences which lie adjacent to each other

---

NOTE: for sort repeated sequences (p.e. AA or AAA), no mismatches are available.

Esta obra está bajo una licencia de Creative Commons. BioScripts está creado por Francisco Gálvez para recopilar todos los proyectos que tiene pensados hacer en 2006-2008.